Skip to main content
Download PDF

Variants of human DECTIN-1 rs16910526 are linked to differential reactive oxygen species production and susceptibility to tuberculosis

Journal of Biomedical Science volume 31, Article number: 77 (2024) Cite this article

Abstract

Background

Dectin-1 is a transmembrane receptor that plays a pivotal role in recognising fungi and Mycobacterium tuberculosis (Mtb). A specific variant, DECTIN-1 rs16910526, results in a truncated receptor that disrupts membrane expression and ligand binding and is clinically associated with recurrent cutaneous mycoses. Previous research has clarified the role of Dectin-1 in boosting immune defenses against mycobacteria by enhancing reactive oxygen species (ROS) production in neutrophils (PMNs). Here, we investigated the association between the rs16910526 variant and Dectin-1 expression in PMNs, as well as intracellular ROS production in response to Mtb. Furthermore, we explored the potential link between the rs16910526 gene variant and TB outcomes in Argentina.

Methods

DNA was extracted from blood samples obtained from a cohort of 178 TB patients and healthy subjects (HS) in Argentina. PCR amplification and sequencing were performed to identify the rs16910526 variant. Flow cytometry was utilised to assess Dectin-1 expression on the PMN plasma membrane and to measure intracellular ROS levels, as indicated by the oxidation of DHR123 in response to the Mtb antigen.

Results

PMNs carrying the rs16910526 variant exhibited diminished Dectin-1 expression and ROS production in response to Mtb (p < 0.0001). In a case‒control study, the rs16910526 variant had an allelic frequency of 0.112 in TB patients and 0.051 in HS. Notably, 10 out of 88 HS and 18 out of 62 TB patients harboured the variant (odds ratio [OR]: 2.55 [95% CI 1.1–5.9, p = 0.03]), indicating a potential association with TB disease. Furthermore, TB patients with the rs16910526 variant exhibited a delayed sputum smear conversion time (p < 0.004) and 100% positivity for acid-fast bacilli smears (p < 0.00001).

Conclusion

Our study identified a significant association between the SNP variant rs16910526 in the DECTIN-1 gene and Dectin-1 expression in the PMN, leading to altered ROS production. The higher frequency of this variant in TB patients compared to HS suggests a possible link with susceptibility to TB disease in Argentina.

Graphical Abstract

Introduction

Mycobacterium tuberculosis (Mtb) is a global pathogen infecting approximately 2 billion people, leading to about 10 million new active tuberculosis (TB) cases and causing around 1.6 million deaths annually as of 2021 [1]. Despite Mtb's relatively low penetration rate of approximately 25%, only a small fraction of infected individuals progress to active disease [2, 3]. The onset of TB is influenced by complex interactions between Mtb, environmental factors, and host genetics. Variations in TB incidence among different races, ethnicities, and families highlight a genetic predisposition to susceptibility [4]. Genetic variations in molecules associated with innate host defence mechanisms correlate with host susceptibility to TB. In particular, numerous single nucleotide polymorphisms (SNPs) have been identified as potential factors contributing to TB resistance or susceptibility. Studies exploring SNPs in TB have pinpointed genetic differences in Toll-like receptor 2 (TLR2) genes, affecting susceptibility to TB. This finding is crucial because TLR2 recognises Mtb and its cell wall components, making it one of the most prevalent genetic variants associated with TB [5]. However, within this context, Dectin-1 (dendritic cell-associated C-type lectin-1) is the only pattern recognition receptor of Mtb for which genetic variants have not yet been thoroughly explored in the context of TB disease.

Dectin-1 is a transmembrane receptor belonging to the glycosylated C-type lectin family (CLR). It consists of an extracellular C-type lectin-like domain (CRD) and a cytoplasmic domain resembling an immunoreceptor tyrosine-based activation motif (ITAM). This receptor initiates downstream signalling and cellular activation and is encoded by the CLEC7A gene, which spans more than 10 million base pairs (Mbps) on human chromosome 12, encompassing six exons [6]. Dectin-1, which is primarily found on monocytes, macrophages, dendritic cells (DCs), neutrophils (PMNs), and a specific subset of T cells, has been extensively researched as a pivotal receptor for fungal β-1, 3-glucans. Dectin-1 can elicit diverse immune responses, including the generation of reactive oxygen species (ROS) [7]. While traditionally studied for its role in defending against fungal infections [8,9,10], research suggests that this receptor recognises diverse ligands beyond β-glucans [11]. This interaction occurs concurrently with TLR2 and has significant immunological implications, including cytokine secretion [12,13,14]. Our previous studies have described how Mtb simultaneously interacts with Dectin-1 and TLR2 to induce ROS generation. This process triggers the activation of p38 MAPK and Syk, initiating programmed cell death in PMNs, which aids in controlling lung tissue inflammation. Moreover, it enhances antigen presentation, contributing to the immune response against TB [15, 16].

A genetic variant of the Dectin-1 gene involves an early stop codon mutation consisting of a SNP (rs16910526, exon 6, chromosome 12; location, 10162354 bp). The mutation (A → C) causes a change in amino acid 238 from tyrosine to a stop codon (Tyr238X), leading to the loss of the last nine amino acids of the CRD. Consequently, this truncation reduces its expression on the cell surface as well as its capacity to bind β-glucan [17, 18]. This genetic variation has been linked to onychomycosis, recurrent vulvovaginal candidiasis, or both [19] and affects the secretion of proinflammatory cytokines [19, 20].

Having established the significant role of Dectin-1 in generating Mtb-induced ROS, our primary objective was to investigate the potential correlation between the presence of the rs16910526 SNP and an impaired ability to initiate the respiratory burst in immune cells responding to Mtb antigens. In pursuit of this objective we aim to gain a comprehensive understanding of how this genetic variant might affect the innate immune response against TB. This exploration seeks to provide valuable insights that could substantially advance both diagnostic and treatment approaches for this disease.

Materials and methods

TB patients and healthy subjects (HS)

All subjects were recruited between 2017 and 2020, were vaccinated with Bacille Calmette-Guérin (BCG) at birth, had no underlying diseases such as cancer, diabetes, or immune-related conditions, and were HIV-negative. The TB patients were diagnosed with active TB at Hospital Muñiz in Buenos Aires, Argentina, which receives the highest volume of TB suspicion from various sources. Diagnosis involved clinical and radiological assessments, acid-fast bacilli detection in sputum samples, and isolation of Mtb in culture. The HS group comprised household contacts and healthy donors from Fundación Hemocentro Buenos Aires. All HS lacked a history of TB (confirmed through chest X-rays and analysis of acid-fast bacilli in sputum) and tested negative for the QuantiFERON-TB Gold In-Tube test (QFT-GIT, Qiagen, USA). Peripheral blood was collected in heparinised tubes from all participants over 18 years old after provided written informed consent for sample collection and analysis. The research procedure complied with the principles outlined in the Declaration of Helsinki and was approved by the Ethical Committee of Muñiz Hospital (protocol code 988/18) and the Ethics Committee of the National Academy of Medicine in Buenos Aires.

Genetic screening for DECTIN-1 rs16910526 variant

Genomic DNA was extracted from whole blood samples from 80 TB patients and 98 HS using Puro Genomic DNA Extraction Kits (PB-L, Productos Bio-Logicos®, Argentina). The presence of the rs16910526 SNP in the DECTIN-1 gene was investigated via polymerase chain reaction (PCR), which amplified the specific DECTIN-1 sequence. Primers targeting the region of interest were used for amplification, sourced from GenBank (chromosome position 12p13, NC-000012.10). The sequences of the primers used are: Sense: 5'AATCACAGCCTCTCCCTTCA 3', Reverse: 5'GATTTAAGCCTCCTTTTCCAA 3'. Subsequent sequencing of the exonic and neighbouring intronic regions of the DECTIN-1 gene was carried out. High-fidelity DNA polymerase and dNTPs (PB-L) were used for PCR, which included 35 cycles of amplification at 94 °C for 5 min, 94 °C for 30 s, 58 °C for 50 s, and 72 °C for 45 s per cycle. For quality control purposes, each PCR set comprised randomly chosen replicates of samples previously typed in the study, along with two negative controls. Consistency in quality control and duplicate samples reached or exceeded 99% agreement across all assays. Importantly, laboratory personnel remained unaware of the sample statuses throughout the process, and sequencing procedures were conducted at Macrogen after amplification.

Antigens

Gamma-irradiated H37Rv Mtb strain was acquired from Bei Resources, NIAID, NIH (Bethesda, MD, USA). Gamma-irradiated bacteria are inactive and non-infectious without losing the structure of the cell wall; the absence of replication of the irradiated bacteria was verified at the mycobacteria service of ANLIS-Malbrán. The bacteria were finally suspended in phosphate-buffered saline (PBS) at an optical density of 600 nm of 1 (~ 108 bacteria/mL). The suspension was stored at −20 °C until experimentation.

Cell preparation and culture

PMNs were obtained from heparinised venous blood using Ficoll-Hypaque gradient centrifugation for 40 min at 350 g and 4 °C, followed by sedimentation for 20 min in a 3% dextran solution (Sigma Chemical Co., St. Louis, Mo, USA). Red blood cells were removed through hypotonic lysis, and PMNs were washed and suspended in RPMI-1640 medium supplemented with 1% heat-inactivated fetal calf serum (FCS), 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco, NY, USA) at a concentration of 3 × 106 cells/mL. The cell viability exceeded 95%, as determined by trypan blue dye exclusion, and the purity reached 95%, as validated through Wright‒Giemsa staining and fluorescence-activated cell sorting (FACS) light scatter pattern analysis.

Oxidative bursts assay

Intracellular reactive oxygen species (ROS) were measured using the 123Dihydrorhodamine assay (DHR), a dye that freely enters the cell membrane and, after oxidation by ROS to rhodamine 123, it emits a bright fluorescent signal. Briefly, 5 × 105 PMNs were incubated with 100 μl of DHR solution (5 μg/mL) at 37 °C for 15 min. Then, Mtb (1 × 106 bacteria/mL) was added for 90 min alongside a positive control of phorbol myristate acetate (PMA) (10 ng/mL) (Sigma) and a negative control of medium alone. Afterward, the PMNs were washed, and 10.000 events were collected using flow cytometry (BD Biosciences) with FSC, SSC, and FL-1 parameters. The results are presented as the index of ROS calculated as the mean fluorescence intensity (MFI) after Mtb stimulation / MFI after culturing with medium.

Dectin-1 expression

Freshly isolated PMNs were assessed using saturating concentrations of monoclonal mouse anti-human Dectin-1-PE-conjugated antibodies (clone 15E2), along with their corresponding isotype controls (R&D Systems Inc., Minneapolis, USA). Briefly, 5 × 105 cells were incubated for 20 min on ice, washed, and fixed with 500 μL of 1% paraformaldehyde. Subsequently, 10.000 cells were collected in a flow cytometer and analysed as described above. The results are presented as the mean fluorescence intensity (MFI).

Statistics

The genotype and allele frequencies were determined through direct counting. Hardy–Weinberg (HW) equilibrium was individually tested for cases and controls using the χ2 test. Genotype frequencies were compared using Fisher’s exact test. Odds ratios (ORs) with 95% confidence interval (CI) were calculated to estimate genotype associations. Correlation analysis was performed using Spearman’s test. Quantitative data are presented as the mean ± standard error of the mean (SEM). Differences among groups were assessed using the Mann–Whitney U test for unpaired and nonparametric samples. Statistical analyses were conducted using GraphPad Prism v7.0 or R software. A p value less than 0.05 was considered to indicate statistical significance.

Results

Demographic and haematological characteristics of the population studied

Laboratory assessments at diagnosis revealed an increased total white blood cell count in TB patients, as previously documented [21] (Table 1), which correlated with an increased percentage of PMNs, a characteristic trait associated with the severity and extent of symptoms [22]. Although no differences were detected regarding the distribution of ages, notable disparities emerged concerning ethnic origins (p < 0.0001) and gender composition (p < 0.04) within both populations. However, no differences in genotype distributions were found by sex within each population (data not shown).

Table 1 Demographic characteristics and laboratory findings at diagnosis in healthy subjects (HS) and TB patients
Full size table

Evaluation of ROS generation and Dectin-1 expression in PMNs from HS and TB patients

The generation of ROS is crucial for eliminating invasive pathogens, promoting apoptosis in PMNs and reducing inflammation by eliminating infected PMNs from the infection site [23, 24]. A previous study revealed that non-opsonized Mtb-induced ROS production hinges on the interaction of Mtb with both Dectin-1 and TLR2, leading to PMN apoptosis without affecting Dectin-1 expression over time [25]. Using DHR dye, we detected greater ROS levels in the PMNs from the HS group than in those from the TB group (Table 2), in response to Mtb. Although Dectin-1 expression tended to be lower in TB patients, the differences were not significant. Nonetheless, we noted a positive correlation between ROS production and Dectin-1 expression (Fig. 1).

Table 2 ROS generation and Dectin-1 expression in PMNs from HS and TB patients
Full size table
Fig. 1
figure 1

Correlation between Dectin-1 expression and ROS index in response to Mtb in PMM from HS and TB patients. PMNs were incubated with DHR and treated with Mtb or left unstimulated for 90 min. Oxidized DHR emission due to ROS generated in the presence of Mtb was then assessed using flow cytometry in the FL-1 channel. The ROS index was calculated as the mean fluorescence intensity (MFI) after Mtb stimulation / MFI after culturing with medium. Dectin-1 expression in fresh peripheral blood PMNs was assessed by labelling with anti-Dectin-1-PE antibodies and the corresponding nonspecific isotype (IgG) using flow cytometry. HS: p < 0.0008, r2 = 0.7316; TB p < 0.0001, r2 = 0.8506 (Spearman test)

Full size image

Distribution of genotype and allele frequencies of the rs16910526 SNP in HS and TB patients

In a case–control study, differences in the allelic distribution and genotype frequencies of the rs16910526 SNP were significant between TB patients and HS. The C allele was notably more prevalent among TB patients (TB = 11.2% and HS = 5.1%, p = 0.042), suggesting an overrepresentation in TB individuals. Genotype frequencies also differed significantly (p = 0.037), particularly with the AC genotype being more common in TB patients (TB = 23% and HS = 12%). Logistic regression analysis showed an odds ratio of 2.55 (95% CI 1.1–5.9, p < 0.03), indicating increased susceptibility to TB for individuals carrying the AC genotype compared to those with the AA genotype (Table 3). Both populations were in Hardy‒Weinberg equilibrium for this SNP (p = 0.77473). Notably, no individuals with the homozygous genotype (CC) were found in the total population studied.

Table 3 Distribution of genotypes and allele frequencies of the rs16910526 SNP variant among patients (TB) and healthy subjects (HS)
Full size table

Association of rs16910526 SNP genotypic variants with ROS production and Dectin-1 expression

Subsequently, we investigated the increase of ROS induced by Mtb in PMNs of different genotypes. Significantly lower ROS production were observed in PMNs with the A/C genotype compared to those with the A/A genotype following Mtb stimulation (p < 0.0001) (Fig. 2A). When analysing TB patients and HS separately, we found that in both cohorts, the presence of the C allele was associated with reduced ROS production (Fig. 2B). Interestingly, while the ROS index was similar in homozygotes from both cohorts, TB patients with the A/C genotype showed lower ROS induction than HS individuals with the same genotype (p < 0.02), suggesting that factors beyond Dectin-1, such as other unexamined polymorphisms, may contribute to this difference.

Fig. 2
figure 2

Mtb-induced ROS production and Dectin-1 expression in PMNs harbouring rs16910526 genotypic variants. A ROS index in the total population (**p < 0.0001); B ROS index in HS and TB patients (A/A versus A/C genotypes **p < 0.0001; A/C in HS vs. TB #p < 0.02); C Representative histogram of DHR emission in samples with A/A and A/C genotypes compared to control (grey line) and unlabelled cells (grey shadow); D Dectin-1 expression in the PMN in the total population (A/A versus A/C genotypes **p < 0.0001); E Dectin-1 expression in HS and TB patients (A/A versus A/C genotypes **p < 0.0001); F A representative histogram of Dectin-1 expression in two different individuals (A/A and A/C) and the corresponding nonspecific isotype (IgG) labelling (grey shadow). The values are expressed as the mean ± SEM of the MFI determined by flow cytometry. P values were calculated using the Mann–Whitney U test for unpaired and non-parametric samples

Full size image

Furthermore, we evaluated the expression of Dectin-1 in PMNs across different genotypes. Consistent with previous reports (20), Dectin-1 expression was significantly lower in PMNs with the A/C genotype compared to those with the A/A genotype (Fig. 2D–F). Notably, individuals without the genetic variant showed no differences in the expression of Dectin-1 between HS and TB patients (Fig. 2E).

Associations between rs16910526 SNP genotypic variants and clinical parameters

In our subsequent analysis, we explored associations between the rs16910526 variant and TB severity by examining clinical parameters. The white blood cell count and PMN percentage differed between the TB group and the HS group (Table 1), but there were no differences in the distribution of the rs16910526 variant (Table 4). Symptoms upon admission in TB patients, including weight loss, night sweats, discomfort or weakness, persistent fever, cough, history of respiratory difficulty, and hemoptysis, displayed no notable differences between genotypes except for AFB in sputum smears (p < 0.00001) or sputum conversion duration (p < 0.004) suggesting that the variant may hinder pathogen control.

Table 4 Associations between clinical parameters and the rs16910526 SNP genotypic variant during active TB
Full size table

Discussion

Certain genetic variants may influence the functionality of the immune system, thereby impacting its ability to recognise pathogens [5]. Although the significant role of Dectin-1 in regulating the immune response against Mtb has been extensively documented [14, 26, 27], the genetic variants of Dectin-1 in TB remain unaddressed. Avoiding ROS production significantly affects the survival of both bacteria and PMNs, potentially assisting Mtb in evading the host's immune defenses, as observed in prevalent Mtb strains in Argentina [28, 29]. This strategy mirrors observations in other pathogens, such as Anaplasma phagocytophilum, which, by failing to induce ROS production, delays PMN apoptosis [30]. The importance of ROS generation in the immune response against Mtb is underscored by the fact that chronic granulomatous disease (CGD) is the primary immunodeficiency most clearly associated with susceptibility to TB [31]. Thus, epidemiological outcomes are shaped by the genetic background of the host and pathogen, their interactions, and the surrounding environment. We chose the rs16910526 SNP due to its significance, despite the identification of five other SNPs located in the 3′UTR (rs11053593 and rs7959451) and intronic region (rs7309123, rs2078178, and rs3901533), which have been clinically linked to various diseases [32,33,34,35]. However, unlike the rs16910526 SNP, there is no definitive evidence of their functional implications.

In this study, we provide evidence that the presence of the rs16910526 genetic variant correlates with reduced Dectin-1 expression on the PMN membrane, consistent with findings in monocytes reported by other researchers [19, 20, 36]. This decrease in Dectin-1 expression translates to a diminished capacity for ROS generation in response to Mtb. Notably, the decreased Mtb-induced ROS production in the PMNs of TB patients appears to be specifically associated with Dectin-1, as previous investigations have indicated heightened activation and increased ROS levels in response to fMLP, a nonspecific chemoattractant stimulus [22]. Therefore, the reduced ROS production in response to Mtb cannot be attributed to an intrinsic characteristic of PMNs from TB patients [37]. Furthermore, individuals carrying the allelic variant also exhibit a diminished capacity for ROS generation in their monocytes (data not shown). However, it is important to consider the potential presence of certain SNPs in TLR2 that may further reduce the capacity to generate ROS in TB patients. Additionally, this decrease should not be attributed to a lower Dectin-1 protein level in TB patients, as no differences were observed between HS and TB patients who did not carry the allelic variant (Fig. 2B). In this context, mRNA expression was found to be equivalent among the different genotypes [20], indicating the absence of Dectin-1 protein expression on the membrane of cells from individuals heterozygous for the genetic variant. Further analysis of the Dectin-1 protein structure bearing an early stop codon revealed the absence of a crucial cysteine disulfide bridge, likely resulting in significant functional implications, as well as the absence of cell membrane expression of Dectin-1 [19].

Neutrophils, the primary cells that rapidly mobilise to infection sites, are commonly recognised for their localised functions, with limited evidence of returning to the bloodstream. The continual influx of activated PMNs from the bloodstream, as indicated by the secretion of IL-1, TNF-α, and IL-8 [22], is correlated with an increased presence of PMNs in the BALF of individuals with active TB [38]. These observations are closely linked to disease severity and the intensity of the inflammatory response [39]. Our study revealed no correlation between the rs16910526 gene variant and white blood cell counts or PMN counts in TB patients. However, this variant was associated with increased AFB levels in sputum smears and prolonged sputum conversion duration, suggesting that this variant may impede pathogen control, likely through ROS signalling, which is vital for innate and adaptive immune responses. Nevertheless we did not explore a direct association between ROS reduction and TB susceptibility, which remains to be established.

Our findings, revealed an overrepresentation of the rs16910526 SNP variant in TB patients, suggesting a potential association with TB susceptibility within the analysed population. However, Dectin-1-deficient mice are resistant to Mtb infection, similar to wild-type mice, indicating that Dectin-1 may play a redundant role in antimycobacterial defense [40].

The intricate nature of TB transmission across diverse populations involves several factors beyond genetic susceptibility. Overcrowded living conditions, inadequate nutrition, weakened immunity, and poor ventilation [41] heighten infection risks [42] and hinder treatment effectiveness. Individuals affected by TB often live in substandard conditions, leading to delays in medical care, especially among those experiencing persistent cough or fever. The study cohort included homeless individuals and, occasionally, nearby immigrants who frequently work in cramped conditions, potentially facilitating disease spread [43]. Although no scientific evidence supports the transmission of Andean strains to Argentinean patients, the dominant strains in Buenos Aires spread among immigrants contracting the disease in clandestine textile workshops. These contextual elements clarify demographic disparities, not solely due to the higher frequency of genetic mutations. Instead, it signifies a complex interplay among social, environmental, and occupational factors influencing disease spread among diverse groups. In this context, one of the main limitations in this study was the difficulty in assembling a larger cohort of healthy household contacts of the patients, as well as the relatively small size of the recruited cohort. The onset of the COVID-19 pandemic may have influenced the immunological status of both healthy individuals and TB patients, prompting us to stop recruiting people. Nonetheless, it is worth noting that the allelic frequency of this variant was 0.09, which is slightly above the global average [19].

Conclusion

Our study identified a significant association between the SNP variant rs16910526 in the DECTIN-1 gene and the expression of Dectin-1, leading to impaired ROS production. Moreover, we observed a potential link between susceptibility to TB and the SNP rs16910526 in the Argentine population. More research is needed to elucidate whether or not there is a direct relationship between the respiratory burst and the development of TB disease. Additionally, investigating the combined effects of TLR2 genetic variants is warranted, given the collaborative role of TLR2 and Dectin-1 in recognising Mtb.

Availability of data and materials

All data generated or analysed during this study are included in this published article.

Abbreviations

AFB:

Acid–Fast Bacilli Smear

BALF:

Bronchoalveolar lavage fluid

CLR:

C-type lectin family

Dectin-1:

Dendritic Cell-associated C-type lectin-1

DHR:

123-Dihydrorhodamine

fMLP:

N-formyl-methionyl-leucyl-phenylalanine

IL-1:

Interleukin-1

IL-8:

Interleukin-8

MFI:

Mean fluorescence intensity

Mtb :

Mycobacterium tuberculosis

PBS:

Phosphate-buffered saline

PCR:

Polymerase chain reaction

PMA:

Phorbol Myristate Acetate

PMN:

Polymorphonuclear Neutrophil

ROS:

Reactive oxygen species

SNP:

Single nucleotide polymorphism

TB:

Tuberculosis

TLR:

Toll-like receptor

TNF-α:

Tumour Necrosis Factor-alpha

References

  1. World Health Organization. Annual Report of Tuberculosis. 2022; 1–68. https://www.who.int/teams/global-tuberculosis-programme/tb-reports/global-tuberculosis-report-2022%

  2. Houben RMGJ, Dodd PJ. The global burden of latent tuberculosis infection: a re-estimation using mathematical modelling. PLoS Med. 2016. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pmed.1002152.

    Article  PubMed  PubMed Central  Google Scholar 

  3. Smith I. Mycobacterium tuberculosis pathogenesis and molecular determinants of virulence. Clin Microbiol Rev. 2003;16:463–96. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/CMR.16.3.463-496.2003.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Houben ENG, Nguyen L, Pieters J. Interaction of pathogenic mycobacteria with the host immune system. Curr Opin Microbiol. 2006. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.mib.2005.12.014.

    Article  PubMed  Google Scholar 

  5. Azad AK, Sadee W, Schlesinger LS. Innate immune gene polymorphisms in tuberculosis. Infect Immun. 2012;80:3343–59. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/IAI.00443-12.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Brown GD, Herre J, Williams DL, Willment JA, Marshall ASJ, Gordon S. Dectin-1 mediates the biological effects of β-glucans. J Exp Med. 2003. https://doiorg.publicaciones.saludcastillayleon.es/10.1084/jem.20021890.

    Article  PubMed  PubMed Central  Google Scholar 

  7. Brown GD. Dectin-1: a signalling non-TLR pattern-recognition receptor. Nat Rev Immunol. 2006;6:33–43. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/nri1745.

    Article  CAS  PubMed  Google Scholar 

  8. Kimberg M, Brown GD. Dectin-1 and its role in antifungal immunity. Med Mycol. 2008. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/13693780802140907.

    Article  PubMed  Google Scholar 

  9. Saijo S, Iwakura Y. Dectin-1 and Dectin-2 in innate immunity against fungi. Int Immunol. 2011. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/intimm/dxr046.

    Article  PubMed  Google Scholar 

  10. Marakalala MJ, Kerrigan AM, Brown GD. Dectin-1: a role in antifungal defense and consequences of genetic polymorphisms in humans. Mamm Genome. 2011;22:55–65. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00335-010-9277-3.

    Article  CAS  PubMed  Google Scholar 

  11. Lee H-M, Yuk J-M, Shin D-M, Jo E-K. Dectin-1 is inducible and plays an essential role for mycobacteria-induced innate immune responses in airway epithelial cells. J Clin Immunol. 2009;29:795–805. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s10875-009-9319-3.

    Article  CAS  PubMed  Google Scholar 

  12. Gantner BN, Simmons RM, Canavera SJ, Akira S, Underhill DM. Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2. J Exp Med. 2003;197:1107–17. https://doiorg.publicaciones.saludcastillayleon.es/10.1084/jem.20021787.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Yadav M, Schorey JS. The β-glucan receptor dectin-1 functions together with TLR2 to mediate macrophage activation by mycobacteria. Blood. 2006. https://doiorg.publicaciones.saludcastillayleon.es/10.1182/blood-2006-05-024406.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Zenaro E, Donini M, Dusi S. Induction of Th1/Th17 immune response by Mycobacterium tuberculosis : role of dectin-1, mannose receptor, and DC-SIGN. J Leukoc Biol. 2009;86:1393–401. https://doiorg.publicaciones.saludcastillayleon.es/10.1189/jlb.0409242.

    Article  CAS  PubMed  Google Scholar 

  15. Romero MM, Duarte A, Pastorini M, Alemán M. Role of α-glucan-induced oxygen species in dendritic cells and its impact in immune response against tuberculosis. Int J Med Microbiol. 2019. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ijmm.2019.07.002.

    Article  PubMed  Google Scholar 

  16. Alemán M. Neutrophil apoptosis in the context of tuberculosis infection. Tuberculosis. 2015;95:359–63. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.tube.2015.03.010.

    Article  CAS  PubMed  Google Scholar 

  17. Cunha C, Di Ianni M, Bozza S, Giovannini G, Zagarella S, Zelante T, et al. Dectin-1 Y238X polymorphism associates with susceptibility to invasive aspergillosis in hematopoietic transplantation through impairment of both recipient- and donor-dependent mechanisms of antifungal immunity. Blood. 2010;116:5394–402. https://doiorg.publicaciones.saludcastillayleon.es/10.1182/blood-2010-04-279307.

    Article  CAS  PubMed  Google Scholar 

  18. Chai LYA, De Boer MGJ, Van Der Velden WJFM, Plantinga TS, Van Spriel AB, Jacobs C, et al. The Y238X stop codon polymorphism in the human b-glucan receptor dectin-1 and susceptibility to invasive aspergillosis. J Infect Dis. 2011;203:736–43. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/infdis/jiq102.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Ferwerda B, Ferwerda G, Plantinga TS, Willment JA, van Spriel AB, Venselaar H, et al. Human Dectin-1 deficiency and mucocutaneous fungal infections. N Engl J Med. 2009. https://doiorg.publicaciones.saludcastillayleon.es/10.1056/nejmoa0901053.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Plantinga TS, Van Der Velden WJFM, Ferwerda B, Van Spriel AB, Adema G, Feuth T, et al. Early stop polymorphism in human DECTIN-1 is associated with increased candida colonization in hematopoietic stem cell transplant recipients. Clin Infect Dis. 2009;49:724–32. https://doiorg.publicaciones.saludcastillayleon.es/10.1086/604714.

    Article  CAS  PubMed  Google Scholar 

  21. Alemán M, Schierloh P, De La Barrera SS, Musella RM, Saab MA, Baldini M, et al. Mycobacterium tuberculosis triggers apoptosis in peripheral neutrophils involving Toll-like receptor 2 and p38 mitogen protein kinase in tuberculosis patients. Infect Immun. 2004;72:5150–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/IAI.72.9.5150-5158.2004.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Alemán M, Beigier-Bompadre M, Borghetti C, De La Barrera S, Abbate E, Isturiz M, et al. Activation of peripheral blood neutrophils from patients with active advanced tuberculosis. Clin Immunol. 2001;100:87–95. https://doiorg.publicaciones.saludcastillayleon.es/10.1006/clim.2001.5044.

    Article  PubMed  Google Scholar 

  23. Kasahara Y, Iwai K, Yachie A, Ohta K, Konno A, Seki H, et al. Involvement of reactive oxygen intermediates in spontaneous and CD95 (Fas/APO-1)-mediated apoptosis of neutrophils. Blood. 1997;89(5):1748–53.

    Article  CAS  PubMed  Google Scholar 

  24. Yadav M, Schorey JS. The β-glucan receptor dectin-1 functions together with TLR2 to mediate macrophage activation by mycobacteria. Blood. 2006;108:3168–75. https://doiorg.publicaciones.saludcastillayleon.es/10.1182/blood-2006-05-024406.Supported.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Romero MM, Basile JI, López B, Ritacco V, Barrera L, Sasiain MC, et al. Outbreaks of Mycobacterium tuberculosis MDR strains differentially induce neutrophil respiratory burst involving lipid rafts, p38 MAPK and Syk. BMC Infect Dis. 2014. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/1471-2334-14-262.

    Article  PubMed  PubMed Central  Google Scholar 

  26. Underhill DM, Goodridge HS. The many faces of ITAMs. Trends Immunol. 2007. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.it.2006.12.004.

    Article  PubMed  Google Scholar 

  27. van de Veerdonk FL, Teirlinck AC, Kleinnijenhuis J, Kullberg BJ, van Crevel R, van der Meer JWM, et al. Mycobacterium tuberculosis induces IL-17A responses through TLR4 and dectin-1 and is critically dependent on endogenous IL-1. J Leukoc Biol. 2010. https://doiorg.publicaciones.saludcastillayleon.es/10.1189/jlb.0809550.

    Article  PubMed  Google Scholar 

  28. Romero MM, Balboa L, Basile JI, López B, Ritacco V, de la Barrera SS, et al. Clinical Isolates of mycobacterium tuberculosis differ in their ability to induce respiratory burst and apoptosis in neutrophils as a possible mechanism of immune escape. Clin Dev Immunol. 2012;2012: 152546. https://doiorg.publicaciones.saludcastillayleon.es/10.1155/2012/152546.

    Article  PubMed  PubMed Central  Google Scholar 

  29. Yokobori N, López B, Ritacco V. The host-pathogen-environment triad: Lessons learned through the study of the multidrug-resistant mycobacterium tuberculosis M strain. Tuberculosis. 2022. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.tube.2022.102200.

    Article  PubMed  Google Scholar 

  30. Borjesson DL, Kobayashi SD, Whitney AR, Voyich JM, Argue CM, Deleo FR. Insights into pathogen immune evasion mechanisms: Anaplasma phagocytophilum fails to induce an apoptosis differentiation program in human neutrophils. J Immunol. 2005;174:6364–72. https://doiorg.publicaciones.saludcastillayleon.es/10.4049/jimmunol.174.10.6364.

    Article  CAS  PubMed  Google Scholar 

  31. Bustamante J, Aksu G, Vogt G, de Beaucoudrey L, Genel F, Chapgier A, et al. BCG-osis and tuberculosis in a child with chronic granulomatous disease. J Allergy Clin Immunol. 2007. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.jaci.2007.04.034.

    Article  PubMed  Google Scholar 

  32. Sainz J, Lupiáñez CB, Segura-Catena J, Vazquez L, Ríos R, Oyonarte S, et al. Dectin-1 and DC-SIGN polymorphisms associated with invasive pulmonary aspergillosis infection. PLoS One. 2012. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0032273.

    Article  PubMed  PubMed Central  Google Scholar 

  33. Bennabi M, Delorme R, Oliveira J, Fortier C, Lajnef M, Boukouaci W, et al. Dectin-1 polymorphism: A genetic disease specifier in autism spectrum disorders? PLoS One. 2015. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0137339.

    Article  PubMed  PubMed Central  Google Scholar 

  34. Fischer M, Spies-Weisshart B, Schrenk K, Gruhn B, Wittig S, Glaser A, et al. Polymorphisms of Dectin-1 and TLR2 predispose to invasive fungal disease in patients with acute myeloid leukemia. PLoS One. 2016. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0150632.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Overton NLD, Denning DW, Bowyer P, Simpson A. Genetic susceptibility to allergic bronchopulmonary aspergillosis in asthma: a genetic association study allergy. Asthma Clin Immunol. 2016. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13223-016-0152-y.

    Article  Google Scholar 

  36. Plantinga TS, Fransen J, Takahashi N, Tienstra R, van Riel PL, van den Berg WB, et al. Functional consequences of DECTIN-1 early stop codon polymorphism Y238X in rheumatoid arthritis. Arthritis Res Ther. 2010. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/ar2933.

    Article  PubMed  PubMed Central  Google Scholar 

  37. Rankin AN, Hendrix SV, Naik SK, Stallings CL. Exploring the role of low-density neutrophils during mycobacterium tuberculosis infection. Front Cell Infect Microbiol. 2022. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fcimb.2022.901590.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Condos R, Rom WN, Liu YM, Schluger NW. Local immune responses correlate with presentation and outcome in tuberculosis. Am J Respir Crit Care Med. 1998;157:729–35. https://doiorg.publicaciones.saludcastillayleon.es/10.1164/ajrccm.157.3.9705044.

    Article  CAS  PubMed  Google Scholar 

  39. Aleman M, Garcıa A, Saab MA, De la Barrera SS, Finiasz M, Abbate E, et al. Mycobacterium tuberculosis – induced activation accelerates apoptosis in peripheral blood neutrophils from patients with active tuberculosis. Am J Respir Cell Mol Biol. 2002;27:583–92. https://doiorg.publicaciones.saludcastillayleon.es/10.1165/rcmb.2002-0038OC.

    Article  CAS  PubMed  Google Scholar 

  40. Marakalala MJ, Ndlovu H. Signaling C-type lectin receptors in antimycobacterial immunity. PLoS Pathog. 2017;13:1–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.ppat.1006333.

    Article  CAS  Google Scholar 

  41. Murray M, Oxlade O, Lin HH. Modeling social, environmental and biological determinants of tuberculosis. Int J Tuberc Lung Dis. 2011. https://doiorg.publicaciones.saludcastillayleon.es/10.5588/ijtld.10.0535.

    Article  PubMed  Google Scholar 

  42. Arrossi S, Herrero MB, Greco A, Ramos S. Factores predictivos de la no adherencia al tratamiento de la tuberculosis en municipios del Área Metropolitana de Buenos Aires Argentina. Salud Colect. 2012. https://doiorg.publicaciones.saludcastillayleon.es/10.18294/sc.2012.866.

    Article  PubMed  Google Scholar 

  43. Grimson A. Relatos de la diferencia y la igualdad los bolivianos en buenos aires [accounts of difference and equality: bolivians in buenos aires]. Nueva Soc. 1997;147:96–107.

    Google Scholar 

Download references

Acknowledgements

We specially thank Dr. Raúl Ruggiero and Dr. Carlos De Brasi for helpful comments and critical reading of the manuscript. We thank Lucio Carnero, for his kind help in the elaboration of the Figures.

Funding

This research was supported by the Instituto Universitario de Ciencias de la Salud, Fundación H.A. Barceló to MA, and Fundación Alberto J. Roemmers to MP.

Author information

Author notes

  1. Mónica Cufré and Mercedes Pastorini have contributed equally to this work.

Authors and Affiliations

  1. Hospital de Infecciosas Francisco Javier Muñiz, Buenos Aires, Argentina

    Mónica Cufré, Ignacio Martín, Rodrigo Failde & Domingo Palmero

  2. Instituto de Medicina Experimental, IMEX-CONICET-ANM, Pacheco de Melo 3081, 1425, Buenos Aires, Argentina

    Mercedes Pastorini & Mercedes Alemán

Authors
  1. Mónica Cufré
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Mercedes Pastorini
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Ignacio Martín
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Rodrigo Failde
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Domingo Palmero
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Mercedes Alemán
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

MA contributed to the conception and design of the study and drafted the article. MC and PM contributed to the acquisition and analysis of the data. MA contributed to the experimental procedures. MC, IM and RF were in charge of patient diagnosis, obtained the blood samples and contributed to the analysis of the clinical data. DP contributed to the analysis of the clinical data and provided methodological support and insightful data. All authors contributed to manuscript revision and read and approved the submitted version. MC and MP equally contributed to the project.

Corresponding author

Correspondence to Mercedes Alemán.

Ethics declarations

Ethics approval and consent to participate

All participants were over 18 years old and provided written informed consent for sample collection and analysis. The research procedure complied with the principles outlined in the Declaration of Helsinki and was approved by the Ethical Committee of Muñiz Hospital (protocol code 988/18) and the Ethics Committee of the National Academy of Medicine in Buenos Aires.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Cufré, M., Pastorini, M., Martín, I. et al. Variants of human DECTIN-1 rs16910526 are linked to differential reactive oxygen species production and susceptibility to tuberculosis. J Biomed Sci 31, 77 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12929-024-01067-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12929-024-01067-w

Keywords

Journal of Biomedical Science

ISSN: 1423-0127